Home
Search results “Dreaming with spiders and webs”
System Of A Down - Spiders
 
03:36
System of a Down's official music video for 'Spiders'. Click to listen to System of a Down on Spotify: http://smarturl.it/SystemSpotify?IQid=SystemSpiders As featured on System of a Down. Click to buy the track or album via iTunes: http://smarturl.it/SystemSOAD?IQid=SystemSpiders Google Play: http://smarturl.it/SpidersGPlay?IQid=SystemSpiders Amazon: http://smarturl.it/SOADAmazon?IQid=SystemSpiders More from System of a Down Chop Suey!: https://youtu.be/CSvFpBOe8eY Aerials: https://youtu.be/L-iepu3EtyE B.Y.O.B: https://youtu.be/zUzd9KyIDrM More great Alternative videos here: http://smarturl.it/Alternative00?IQid=SystemSpiders Follow System of a Down Website: http://www.systemofadown.com/ Facebook: https://www.facebook.com/systemofadown Twitter: https://twitter.com/systemofadown Instagram: https://instagram.com/systemofadown/ Subscribe to System of a Down on YouTube: http://smarturl.it/SYODSub?IQid=SystemSpiders --------- Lyrics: The piercing radiant moon, The storming of poor June, All the life running through her hair, Approaching guiding light, Our shallow years in fright, Dreams are made winding through my head, Through my head, Before you know, Awake, Your lives are open wide, The V-chip gives them sight, All the life running through her hair, The spiders all in tune, The evening of the moon, Dreams are made winding through my head, Through my head, Before you know, Awake
Views: 79821447 systemofadownVEVO
Lucas the Spider - Spinning Webs
 
00:45
Lucas the Spider isn’t just cute and funny animal, he’s smart too! He isn't about to let a little adversity keep him down. Anything is possible for this animal because he dreams big! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider-shop © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 8291731 Lucas the Spider
System of a Down - Spiders Lyrics
 
03:37
https://soundcloud.com/g-karal
Views: 3363282 C.arlos
blink-182 - I Miss You
 
03:50
Music video by blink-182 performing I Miss You. (C) 2003 Geffen Records
Views: 217448697 blink182VEVO
Spider Web Dream Catcher Tutorial
 
12:43
This nature inspired dream catcher is inexpensive and makes a really cute wall decorative. Things Required -Embroidery Hoop -Thread -Needle -A pair of scissors -Marker -Feathers -Tree Branches TIPS- -Preferably use a wooden hoop, if you get a plastic one make sure you paint it brown so that its not very conspicuous through the branches -Use a bigger needle -Though colorful feathers might solve the purpose, natural feathers would look the best -For marking equal segments on the hoop, you can fold a paper 4-5 times and use the creases as measurement *music credits* Song: Nova Artist: Ahrix Album: Nova Licensed to YouTube by RouteNote (on behalf of Ahrix); Routenote (Publishing), CMRRA, Abramus Digital, ASCAP, Broma 16, and 19 music rights societies Buy it now on Google Play
Views: 176513 All That Glitters
Coldplay - Trouble
 
04:53
Get A Head Full Of Dreams now: – iTunes http://cldp.ly/cpitunes – Amazon http://smarturl.it/AHFODamazon – Google Play http://smarturl.it/AHFODgplay – CD (with exclusive holographic stickers) http://smarturl.it/AHFODcd – Vinyl (with exclusive holographic stickers) http://smarturl.it/AHFODvinyl ~ Follow Coldplay ~ Website: http://www.coldplay.com Twitter: https://twitter.com/coldplay Facebook: https://www.facebook.com/coldplay Instagram: http://instagram.com/coldplay Google+: http://instagram.com/coldplay Tumblr: http://coldplay.tumblr.com/ VK: https://vk.com/coldplay
Views: 107669414 Coldplay
The Cure - Lullaby (Official Music Video)
 
04:10
Watch the official video for 'Lullaby' by The Cure from the 1989 album Disintegration Subscribe to the Rhino Channel! http://bit.ly/SubscribeToRHINO Check Out Our Favorite Playlists: Rhino Favorite 100 http://bit.ly/RhinoFavorite100 80s Hits http://bit.ly/80sMusicHits Classic Rock http://bit.ly/ClassicRockFavorites Stay connected with RHINO on... Facebook https://www.facebook.com/RHINO/ Instagram https://www.instagram.com/rhino_records Twitter https://twitter.com/Rhino_Records https://www.rhino.com/ Stay connected with The Cure on... Facebook https://www.facebook.com/thecure/ http://www.thecure.com/ RHINO is the official YouTube channel of the greatest music catalog in the world. Founded in 1978, Rhino is the world's leading pop culture label specializing in classic rock, soul, and 80's and 90's alternative. The vast Rhino catalog of more than 5,000 albums, videos, and hit songs features material by Warner Music Group artists such as Van Halen, Duran Duran, Aretha Franklin, Ray Charles, The Doors, Chicago, Black Sabbath, John Coltrane, Yes, Alice Cooper, Linda Ronstadt, The Ramones, The Monkees, Carly Simon, and Curtis Mayfield, among many others. Check back for classic music videos, live performances, hand-curated playlists, the Rhino Podcast, and more!
Views: 5761758 RHINO
Lucas the Spider - Captured
 
00:31
Oh no, Lucas the Spider may or may not know that he is in danger! What will happen? This spider will have to dream big to get out of this one! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider-shop © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 20118278 Lucas the Spider
Lucas the Spider - Musical Spider
 
00:33
Did you hear that – is Lucas the Spider trying to play an instrument? I didn’t know animals could play music! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider-shop © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 22904919 Lucas the Spider
Social Spiders Spin Massive Nest
 
03:29
Social spiders can build nests more than 20 feet across. Please LIKE and SUBSCRIBE if you enjoyed! http://bit.ly/1Adl6ht **More info & videos below** A spider found in parts of the Caribbean and South America forms colonies that comprise thousands of individuals. Working together these colonies can build nests more than 20 feet across. "Animal Homes: Cities" premieres April 22, 2015 at 8/7c on PBS. Check your local listings. http://www.pbs.org/wnet/nature/animal-homes/11674/ --- For full NATURE episodes, check out http://www.pbs.org/wnet/nature/ Facebook: http://www.facebook.com/pbsnature/ Twitter: http://twitter.com/pbsnature/ Tumblr: http://pbsnature.tumblr.com/ Instagram: http://instagram.com/pbs_nature/ ----------------- Nature is a production of THIRTEEN for PBS. Throughout its history, Nature has brought the natural world to millions of viewers. The PBS series has been consistently among the most-watched primetime series on public television. ----------------- More videos: Sea otter orphan gets adopted: https://www.youtube.com/watch?v=qdy7DEhvsVU Owl silent flight: https://www.youtube.com/watch?v=6pWub12DUoU Bullfrog dad protects tadpoles: https://www.youtube.com/watch?v=l3uO2lO9JDk Gorilla mating games: https://www.youtube.com/watch?v=3431b8twU-U Snow Monkeys behind the scenes: https://www.youtube.com/watch?v=dDusYMTcyg4
Views: 36525 Nature on PBS
It's raining spiders! Spider rain phenomenon explained
 
02:12
After a small Australian town was recently covered by spiders raining from the sky, we explain what exactly spider rain is. Report by Claire Lomas.
Views: 871064 ODN
Lucas The Spider - One Man Band
 
00:58
What animal do you know can play multiple instruments? Lucas the Spider, that’s who! Anything is possible if you dream big! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider-shop © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 6485137 Lucas the Spider
Lucas the Spider - Encore
 
00:39
Lucas the Spider is the world’s most musical animal! But it takes a lot of hard work, dedication, practice and you have to dream big! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider-shop © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 18849676 Lucas the Spider
No Doubt - Spiderwebs
 
04:04
Best of No Doubt: https://goo.gl/arujs7 Subscribe here: https://goo.gl/HRNLKB Music video by No Doubt performing Spiderwebs. (C) 2003 Interscope Records
Views: 17347532 NoDoubtVEVO
SPIDER WEBS!!! Super powerful!
 
06:04
Heres a quick witchy tidbit on spider webs and their uses. We are collecting some we have been letting grow for a bit and will be using them soon! Do throw yours out! Keep them! They can kick some serious ass for you!
Views: 287 Hex Arcanum
This Puppy-Sized Spider Will Haunt Your Dreams
 
01:12
According to the Guinness Book of World Records, the world’s largest spider is the Goliath birdeater native to South America. These huge spiders can weigh more than 6 ounces, with legs spanning up to a foot. According to the Guinness Book of World Records, the world’s largest spider is the Goliath birdeater. Native to South America, these huge spiders can weigh more than 6 ounces, with legs spanning up to a foot. Piotr Naskrecki, an entomologist and photographer at Harvard University's Museum of Comparative Zoology, studied the birdeater spiders, and compared them to the size of a puppy. While some experts think that the giant huntsman spider is larger because of its impressive leg span, the birdeater spiders are actually more massive. They are named birdeaters because one was observed eating a hummingbird, but their diet mainly consists of earthworms and other small animals they find on the ground in their jungle habitat. Even though these spiders aren’t deadly to humans, they can still inflict some damage with their two inch fangs. They also have microscopic barbs on their hair that when stuck on a predator, can cause pain, itchiness, and discomfort for days. Naskrecki is quoted as saying: "I've been working in the tropics in South America for many, many years, and in the last 10 to 15 years, I only ran across the spider three times." He captured one female specimen in Guyana, which was given to a museum after being studied.
Views: 3191751 GeoBeats News
Spider as a Spirit Guide--What it Means When You Are Suddenly Seeing Spiders Everywhere
 
25:26
This video will teach you everything you ever wanted to know about what it means when Spider shows up as a spirit guide for you (You are suddenly getting spider-bites, seeing spiders everywhere, are feeling a new fear of or affection for spiders, people start sending you pictures and cards and gifts with spiders, etc.). You will learn how Spider can teach you how to create a happier life for yourself--especially with regard to money!, how to tackle challenges that feel too big to handle and how to deal with issues of feeling afraid and/or victimized. And if you're not sure if Spider is simply acting as your current spirit guide or is instead your personal totem, you can check out my video on the difference between totems and spirit guides, as well as my upcoming video, "Spider as a Totem" (Coming within the next two weeks, so stay posted!).
Views: 40955 Jordana Van
First Ever Video of Silkhenge Spider Birth
 
03:23
Silkhenge, Mystery Web Tower, White-Picket Fence Structure- whatever the name, it is a spider egg surrounded by mystery. What species is it? What is the function? How is it made? For any licensing requests please contact [email protected] Another expedition, another clue. This time, video of the birth and a DNA barcode sequence. The sequence is open access, below: Web tower-COI-5P GACTTTATATTTGTTATTTGGAGTATGGGCTGCTATAGTTGGGACTGCAATAAGAGTATTAATTCGAGTTGAGTTAGGGCAACCAGGAAGATTATTAGGGGATGATCAACTATATAATGTAATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAATTTTAATTGGGGGATTTGGAAATTGATTAATTCCTATAATGTTAGGAGTACCTGATATAGCTTTTCCTCGGATAAATAATCTTAGTTTTTGATTATTACCCCCTTCTTTGTTTTTACTTTTAATTTCTTCTTTAAATGAAATAGGAGTTGGGGCTGGGTGAACAGTATACCCTCCTTTATCTTCTTTGGAAGGTCATAATAATAGATCTATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCATCTTCAATTATGGGAGCAATTAATTTTATTACTACAATTATAAATATACGGAGAGTAGAATTTAAAATAGAAAATATTTCTTTATTTATTTGATCTGTTTTAATTACAGCAGTACTTTTATTATTGTCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGTAATTTTAATACATCTTTTTTTGATCCTTCTGGAGGAGGGGACCCTGTTTTATTTCAACATTTATTT Link to the BLAST website where we aligned the piece of DNA https://blast.ncbi.nlm.nih.gov We found a total of 5 silkhenge structures and watched three spiders hatch from this. Filmed on an olloclip and Canon 70D. Subscribe to Aaron's channel on YouTube: https://www.youtube.com/channel/UCHr0u7Jsktou2CFl2GhTxYA Visit Yasuni Naitonal Park at http://www.Yasuni.ec Special thanks to Tropical Herping for guiding us through to Yasuni. Want to visit there? Check them out: http://tropicalherping.com/
Views: 1661697 The Jungle Diaries
Blink 182 - I Miss you
 
03:42
Blink 182 I Miss You Lyric Rate and Comment Please copyright goes to blink 182
Views: 30832477 SgtFireEles
How does a Spider make its web? | #aumsum #kids #education
 
05:23
On its underside, a spider has organs called spinnerets that spin silk threads. First, it connects two end points like two branches with silk threads, forming a bridge. It then releases a loose thread. From its center, it adds a new thread, pulling it to form a Y shape. It joins the 3 points to form a frame. Then lays radial threads till the web becomes strong enough. Finally, from the center, it spins spirally completing the web.
Views: 101545 It's AumSum Time
Spider Totem: Spirit Meaning of Spider
 
19:11
Do you identify with Spiders (or do they scare the pants off of you)? Has #Spider appeared to you lately in dreams or other ways? Spider may be your #totem animal, or perhaps it is a #poweranimal guide with a message for you. Listen in for insights into the #spiritanimal meaning of Spider. Check out my Spirit Animal Awareness oracle card deck here: https://www.etsy.com/listing/642491331/spirit-animal-awareness-oracle-card-deck?ref=shop_home_active_1 If you would like personal guidance in understanding your Spider dreams or experiences, you can book a reading with me here: https://spiritanimaloracle.as.me/schedule.php?appointmentType=category%3ASpirit+Animal+readings
Views: 9906 Art of Awakening
Thousands Of Spiders Built Massive Communal Webs In Texas
 
01:08
In the Dallas suburb of Rowlett, thousands of tiny spiders have covered a series of trees with webs in a communal food-catching effort that has some residents a bit freaked out. Typically, you'd see a spider working by itself to build a web.  However, on a football-field length of CA Roan Drive in Rowlett, Texas, thousands of spiders have come together to build a massive series of communal webs 40 feet into the trees.  The species of spider responsible for the community-oriented web construction is not yet known, but is likely to be a member of the Tetragnathidae family, who made similar shroud-like work in neighboring Lake Tawakoni State Park in 2007.  Mike Merchant, an urban entomologist from Texas A&M's AgriLife Extension Service, explained, “Arachnologists had previously noted that this species is known to build communal nests when conditions are right. But it is rare to see them building such large nests in the U.S. Spider experts have indicated that those ‘right conditions’ appear to include a glut of small insects like midges that emerge at night from lakes.”  And the insects from nearby Lake Ray Hubbard seem to fit the bill.  The spiders pose no harm to humans, and similar works of arachnid art have also been spotted in Sindh, Pakistan—where flooding, not food, forced some spiders into the trees as well.
Views: 182037 GeoBeats News
"Dreaming" - Webs (Sabre Ronzh's Ep.)
 
01:38
Thanks for watching, ops in comments? LIKE, SHARE, SUBSCRIBE!!!
Views: 89 Webs VFX
Astonishing of Spider webs pretty. " Spider web"
 
01:46
Hope you like our compilation, please share it and SUBSCRIBE! Watch also our other videos! youtube Subscribe to this ►► https://goo.gl/93XuWY ✔️ THANK YOU ✔️ Astonishing of Spider webs pretty. It’s fascinating to watch spiders spin their webs. What makes a particular spider create one design, while another will come up with something totally different? They truly are works of art, which catch flies as a bonus. Spider web. #SpideWebs #Spide #ArchimedesChannel
Views: 680 Archimedes Channel
M3E   Little Dream Spiders
 
09:47
Mark Elliot Bergman leads M3E (Mason Modern Music Ensemble) in a performance of Kyle Kindred's "Little Dream Spiders."
Views: 115 Mark Bergman
FMQ Spider Webs with Rob!
 
07:08
Click here for supplies: http://bit.ly/spiderwebsfmq_yt Click here for the free printable: https://www.missouriquiltco.com/land/mansewing/fmq-spider-webs-quilt/assets/fmq-spiderweb.pdf Rob demonstrates a spider web stitch motif for cool, Halloween projects like his Science Jars quilt. For this project he is using glow in the dark thread. Click here for the Science Jars quilt tutorial: http://bit.ly/sciencejars_yt Get supplies by clicking the link below: https://www.missouriquiltco.com/land/mansewing/fmq-spider-webs-quilt/index.html?utm_campaign=qt_tms194&utm_medium=Social&utm_source=youtube&utm_content=qt_tms194&utm_term=mansewing
Views: 10420 Man Sewing
A Plague Of Spiders Has Completely Covered An Australian Town In Webs
 
02:05
Imagine waking up to a beautiful snow blanketed field outside of your picturesque farm. But wait… it’s still summer so obviously that couldn’t be snow. You walk outside your front door to take a closer look and immediately your skeleton jumps out of your skin from the most disturbing sight you’ve ever seen! Spiders! Millions and millions of creepy crawly spiders! That’s exactly what happened in a small town in Australia called Wagga Wagga. Recent floods have covered miles and miles of once lush green land with feet of muddy water. This caused the evacuation of over 13,000 people. Well, naturally spiders aren’t the biggest fans of detrimental water levels either so they took to the hills. Millions of spiders had to migrate to higher ground to escape the flooding. This caused an extreme population of the evil little creatures to congregate in one small area. Take a look at these horrifying images that are causing nightmares around the world. This is why you want to stay far away from Australia. -~-~~-~~~-~~-~- Please watch: "This Navy Man Reunited With His Son After Weeks Away Then He Discovered His Wife Had Been Lying1" https://www.youtube.com/watch?v=J7dER2ocfTk -~-~~-~~~-~~-~-
Views: 1031 Behind The World
Spider-Man Movie (2002) - Peter's New Powers Scene (2/10) | Movieclips
 
03:04
Spider-Man - Peter's New Powers: Peter (Tobey Maguire) discovers his new web-slinging abilities. BUY THE MOVIE: http://bit.ly/2ggcqEY Watch the Best Spider-Man Scenes & Clips: Spider-Man Best Scenes Playlist: http://j.mp/2h4nnX0 About Spider-Man Movie: After incorporating elements of comic book style and design into many of his films, director Sam Raimi helms this straight-ahead, big-budget comic book adaptation, which also marks acclaimed young actor Tobey Maguire's first dip into live-action blockbuster filmmaking. Spider-Man follows the template of the original Stan Lee/Steve Ditko source material, with hero Peter Parker an orphaned, intellectual teen loner living in Queens with his aunt (Rosemary Harris) and uncle (Cliff Robertson), and dreaming of the girl next door, Mary Jane (Kirsten Dunst). On a field trip to a Columbia University lab, Peter is bitten by a genetically altered spider and overnight he gains superhuman strength, agility, and perception. At first, Peter uses his powers for material gain, winning a wrestling match with a purportedly lucrative prize. But when Peter apathetically fails to stop a burglar from robbing the wrestling arena, a tragedy follows that compels him to devote his powers to fighting crime -- as the superhero Spider-Man. When he's not busy fighting crime in a spider suit, Peter moves into an apartment with his best friend, Harry (James Franco), and begins work as a photographer at the Daily Bugle. Meanwhile, his do-gooder alter ego finds a nemesis in the form of the Green Goblin (Willem Dafoe), a super-powered, megalomaniacal villain who happens to be the alter ego of Harry's father, weapons-manufacturing mogul Norman Osborn. Spider-Man was written by the prolific blockbuster scribe David Koepp (Jurassic Park, Panic Room). CREDITS: TM & © Sony (2002) Cast: Tobey Maguire Director: Sam Raimi Producers: Avi Arad, Ian Bryce, Grant Curtis, Heidi Fugeman, Stan Lee, Steven P. Saeta, Laura Ziskin Screenwriters: Steve Ditko, David Koepp, Stan Lee About Movieclips: Subscribe for more Movie Clips: http://bit.ly/1u2yaWd Like us on FACEBOOK: http://on.fb.me/1y8M8ax Follow us on TWITTER: http://bit.ly/1ghOWmt Pinterest: http://bit.ly/14wL9De Tumblr: http://bit.ly/1vUwhH7 The MOVIECLIPS channel is the largest collection of licensed movie clips on the web. Here you will find unforgettable moments, scenes and lines from all your favorite films. Made by movie fans, for movie fans.
Views: 42553061 Movieclips
The Spider's Web: Britain's Second Empire (Documentary)
 
01:18:02
At the demise of empire, City of London financial interests created a web of secrecy jurisdictions that captured wealth from across the globe and hid it in a web of offshore islands. Today, up to half of global offshore wealth is hidden in British jurisdictions and Britain and its dependencies are the largest global players in the world of international finance. The Spider's Web was written, directed and produced by Michael Oswald, you can sponsor his future films on Liberapay (supports one time donations) and Patreon: https://liberapay.com/IndependentPOV https://www.patreon.com/independentdocumentary Share this documentary with your friends, and ask sites to feature it: https://twitter.com/spiderswebfilm https://www.facebook.com/Spiderswebfilm/ https://www.imdb.com/title/tt6483026/ The Spider's Web was substantially inspired by Nicholas Shaxson's book Treasure Islands you can read an extract of it here: https://www.theguardian.com/theguardian/2011/jan/08/jersey-tax-haven-nicholas-shaxson Translate this documentary here on youtube or contact us for the .srt file [email protected] For those interested to learn more about tax justice and financial secrecy, read about the Tax Justice Network's campaigning and regular blogs - become part of the movement for change and listen to the Tax Justice Network's monthly podcast/radio show the Taxcast https://www.taxjustice.net/taxcast/ Review on Filmotomy: https://filmotomy.com/the-spiders-web-britains-second-empire/ Review on Open Democracy: https://www.opendemocracy.net/en/opendemocracyuk/film-review-spider-s-web-britain-s-second-empire/ Website: www.spiderswebfilm.com German Version: https://youtu.be/1ZZR8vBKqwc Spanish Version: https://www.youtube.com/watch?v=85dsTnbhchc French Version: https://www.youtube.com/watch?v=hizj_6EH34M Italian Version: https://www.youtube.com/watch?v=VwmvXLamkto&t=1s Subtitles: French, Spanish, German, Italian, Russian, Arabic, Korean, Hungarian, English, Turkish, Portugese.
Views: 1585730 Independent POV
Spider-Man Sings A Song (Avengers Infinity War Parody)
 
03:58
Massive thank you to the talented Robert Grace check him out here - https://www.youtube.com/user/robdbob And thank you to Easy2SingKaraoke for the See You Again Instrumental - https://www.youtube.com/watch?v=_T6apN__vLY + Connect with the Don + + iTunes - https://itun.es/gb/SeEadb + Spotify - https://open.spotify.com/artist/4p8Bt7SQvRh11dl9caLNNK + Instagram - https://www.instagram.com/frasernash + Twitter - https://twitter.com/frasernash + Snapchat - fraser-nash + PS4 - DonFraserNash Here's the lyrics -Spider-Man Mr Stark I swear I’m ready, I promise I’m not a kid, The avengers could really do with, A cheeky arachnid, I been fighting crime undercover and I, Found some really bad men, And I’ll prove you wrong, When I bring em all in, Ok so I kinda messed up, Bird man dropped me in lake, But I promise I’ll arrest them next time, It’ll be a piece of cake, I got leads stark I can’t just give up, Please don’t make me give in, I will prove you wrong, When I bring em all in, I’m swinging here and there, Spider webs everywhere, Your friendly neighbourhood Spider-Man looks out for ya, Sometimes I slip sloppy, I trip and fall whoopsie, My best friend neddy says “oh he’s just being spidey”, But when I catch vulture, I’ll be an avenger, My head it can’t rest till then, Oh woah woah I, I can’t wait to join them again, There’s a girl I think I love her, She’s clever and so pretty, But every time I want to tell her, I have my spider duties, I finally get to take her to the ball and, Wait... that’s your daddy? Oh no no, no nights off for me, “It’s time to fight me spidey” I’m swinging here and there, Spider webs everywhere, Your friendly neighbourhood Spider-Man looks out for ya, Sometimes I slip sloppy, I trip and fall whoopsie, My best friend neddy says “oh he’s just being spidey”, But when I catch vulture, I’ll be an avenger, My head it can’t rest till then, Oh woah woah I, I can’t wait to join them again, Listen vulture I don’t wanna hurt ya, so please just give yourself in? I’m swinging here and there, Spider webs everywhere, Your friendly neighbourhood Spider-Man looks out for ya, Sometimes I slip sloppy, I trip and fall whoopsie, My best friend neddy says “oh he’s just being spidey”, But when I catch vulture, I’ll be an avenger, My head it can’t rest till then, Oh woah woah I, I can’t wait to join them again Oh woah woah I, I can’t wait to join them again
Views: 1655413 Aaron Fraser-Nash
Lucas the Spider - Naptime
 
00:39
Zzzz… Lucas the Spider is a very sleepy animal! I hope he finds a cozy spot to rest his big eyes. Sweet dreams! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider-shop © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 8714837 Lucas the Spider
Don't Be Afraid of Spiders!
 
04:08
A SciShow Kids viewer wants to know more about spiders so she’s not afraid of them anymore. And know what? They’re not scary! They’re awesome! Special Thanks to The Missoula Insectarium for letting us film their beautiful Orb Weaver. Check them out! http://www.missoulabutterflyhouse.org/ ---------- Like SciShow? Want to help support us, and also get things to put on your walls, cover your torso and hold your liquids? Check out our awesome products over at DFTBA Records: http://dftba.com/SciShow Or help support us by becoming our patron on Patreon: https://www.patreon.com/scishow ---------- Looking for SciShow elsewhere on the internet? Facebook: http://www.facebook.com/scishow Twitter: http://www.twitter.com/scishow Tumblr: http://scishow.tumblr.com Instagram: http://instagram.com/thescishow SOURCES: http://www.biokids.umich.edu/critters/Araneidae/ http://www.caaspp.org/rsc/pdfs/activities/ELA_Spiders-and-Insects_CA.pdf http://www.explorit.org/science/spider.html
Views: 1064884 SciShow Kids
Tentsile tree tents: floating treehouses mimic spider webs
 
13:03
Treehouse architect Alex Shirley-Smith wanted to create a portable treehouse, a kind of ready-made, floating shelter that could be assembled in any backyard, wood or even city streets. In 2010 Shirley-Smith released several tree tent prototypes inspired by spiders' webs. "A spider always uses three anchoring points and the web finds its own position in space that's a circle in between any of those 3 points. So as long as you've got 3 anchoring points this tent will find its own central position to create its own shape inside that triangle. The whole thing is sort of taken from spider's web technology or you know, what exists in nature. Biomicmicry." After refining 11 prototypes, Shirley-Smith and partner Kirk Kirchev finally released a production model tree tent- the Tentsile Stingray. Using just 3 tree straps, 2 poles and one fly sheet, the Stingray will shelter up to 4 people in mid-air. It takes about 10 minutes to set-up and a few minutes to take down. And best of all, it is one size fits all. The tent can be used as a camping alternative- to keep you comfortably suspended above any animals, bugs or uncomfortable rocks-, but the design could also prove the basis for a new type of eco-village. Kirchev dreams of one day creating a community of (much larger) tensile structures where portable villages could be mounted and disassembled in a day, leaving little impact on the forest floor. Tentsile: http://www.tentsile.com/ Original story: http://faircompanies.com/videos/view/tentsile-tree-tents-floating-treehouses-mimic-spider-webs/
Views: 2470472 Kirsten Dirksen
Bug Spray Kills Spider, Spawns Nightmare
 
01:41
#Outrageous_Acts Wednesdays 9/8c on Science Channel When Australian Brent Askwith gave this spider the bug spray treatment, nature inflicted her cold revenge by birthing nightmares all over his floor. http://www.sciencechannel.com/tv-shows/outrageous-acts-of-science/ Full episodes streaming FREE on Science GO: https://www.sciencechannelgo.com/outrageous-acts-of-science/ Check out Brent Askwith's YouTube channel: https://www.youtube.com/user/baskwith Subscribe to Science Channel: http://www.youtube.com/subscription_center?add_user=sciencechannel Check out SCI2 for infinitely awesome science videos. Every day. http://bit.ly/SCI2YT
Views: 20097064 Science Channel
Spider-Man Costume Replica Mask with Magnetic Eye Frames (unfinished)
 
01:23
Here’s a little video I made of a mask I’m working on :) Check out what the complete spiderman costume looks like in this video: https://youtu.be/TyBomzQLb7s See more of the suit on my youtube channel: https://www.youtube.com/SpideyPlanet Subscribe for more to come: https://www.youtube.com/subscription_center?add_user=SpideyPlanet Thanks to new 3D printing technology I managed to take the spider-man costume to the next level. Under the spiderman mask there's a 3D printed face shell mask. The eye frames lock into the 3D printed face shell mask magnetically. This way the eyes of spiderman are easily removable from the costume for enhanced comfort, like they are on the original movie suit. The spider man 3D raised webs are casted in urethane from digitally milled molds and afterwards glued onto the 3D printed face shell mask with the fabric in between. This means the entire face is one solid part, so the person wearing the spiderman mask does not have to worry about any positioning around the face area. Anyone wearing the spiderman costume will have the perfect head shape. The 3D printed face shell mask comes in 3 different sizes to allow a perfect fit for any shape of head. I have been working on the spiderman suit since 2003. In this time period I made many costumes, each new spider-man suit slightly improving over its predecessor. Last year I finally reached the point where I managed to completely blow myself away by the result of all developments coming together in one spiderman costume. I am unable to hide my excitement when doing a new film shoot or seeing the spider man suit in action. The costume truly is a dream come true. You can find me and my spiderman costume on: http://www.Facebook.com/SpideyPlanet http://www.YouTube.com/SpideyPlanet http://www.SpideyPlanet.com
Views: 26316893 SpideyPlanet
Jurassic Spider Eats Birds
 
03:42
This giant spider is not just known for eating birds. The massive golden silk orb-weaver spider spins a web that is considered magical! Rumpelstiltskin’s got nothing on the golden silk orb-weaver spider when it comes to spinning golden thread. This spider doesn't even need straw as a raw material. Among it’s many other amazing uses, it’s silk can even repair human nerve cells. They are more commonly known as banana spiders, not to be confused with the Brazilian wandering spider which is the world’s deadliest spider, these banana spiders live in the warmer areas of the Americas from North Carolina to Argentina. Their genus name nephila in Ancient Greek means “fond of spinning” but their origin is way older then Ancient Greek times. Nephila spiders are the oldest surviving spider genus in the world, dating back 165 million years to the middle Jurassic period, so maybe they’ll throw them in the next Jurassic Park Sequel. Now they may not be Jurassic sized like the giant huntsman spider, the largest spider in the world, but a 2 and ¾ inch banana spider was seen catching, killing, and eating an entire finch, and another one in Queensland Australia was seen killing and eating a foot and a half long brown tree snake. Golden orb-weavers have a venom with a neurotoxic effect similar to black widow spider but MUCH less powerful. If one bit YOU, the redness and swelling would be gone in about a day. People have described the bite as being much less severe than even a bee sting. Speaking of bees let’s talk about the AMAZING strength AND uses for the silk orb-weavers webbing. With the thickness of a human hair It has the strength to stop a bee flying 12.5 mph, almost twice the top speed of a house fly. It’s 6 x stronger than steel and even stronger then Kevlar, but possibly it’s best quality is that it’s very stretchy. These three qualities has lent too a WIDE variety of uses for the spider’s silk webbing. It’s been used to produce the cross hairs in microscope eyepieces, spun into violin strings in Japan, and even used to make an entire golden cape. Fisherman in the indo-pacific ocean ball it up and throw it into the water where it expands to become a net to catch bait fish, and natives in the South Pacific eat the pregnant females, raw or roasted, as a protein supplement. The most amazing potential use for the golden silk orb-weaver’s webbing is in the field of medicine. Research is being done involving the growth of nerve cells ON the web filaments, and then using those as nerve grafts. The beauty is that the immune system doesn’t recognize the silk so the body won’t attack or reject it. Now there’s a spider that can be called a productive member of society. World's Deadliest Spider http://youtu.be/pQYWBmk_V2g World's Largest Spider http://youtu.be/gths8z60j_w Videos (Creative Commons Attribution): -Materials in Motion: Super Elastic Plastic©Alli Dryer Vimeo Let's Connect -- http://www.epicadamwildlife.com/ -- http://www.facebook.com/epicadamwildlife -- http://www.twitter.com/epicwildlife -- http://gplus.to/epicwildlife
Views: 7136561 Epic Wildlife
Spiders and Webs, Santa Cruz Mountains
 
00:30
spiders, webs, sun and stream...
Views: 214 Jack D. Deal
Lucas the Spider - Playtime
 
00:22
Lucas the Spider is one funny animal with big dreams. One child's bathroom sink is another one's cute, little playground! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider-shop © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 16589362 Lucas the Spider
14 World's Largest Spiders
 
05:53
From the scary fast Egyptian Giant Solpugid to huge Goliath Bird Eating spider these are the biggest spiders crawling in the world!! Subscribe to Talltanic http://goo.gl/wgfvrr 10.Golden Silk Orb­Weaver The male orb weaver is very small, only growing up to 1 inch in length. The female wears the pants in the relationship as it can grow up to 3 inches in length and have a leg span of just over six inches. These spiders are natives of Australia and their name comes from the fact that they spin giant, orb like webs and sit in the middle of those webs waiting for unassuming prey to get caught and become their next meal. 9.Giant House Spider Unfortunately for everyone, these giant spiders are often found roaming around people’s homes, especially in the Autumn when they are looking for a mate. They are also not as shy as most other spiders and are not afraid to venture out of the crevices and dark places that they like to live in. Typically their legs only span 3 to 4 inches but people have reported finding spiders up to 7 inches in leg span. Like a lot of spiders the male is eaten by the female after mating. In 2015 after a particularly wet summer in the UK sightings of these terrifying spiders vastly increased. 8.Brazilian Wandering Spider Amongst spiders, the Brazilian Wandering Spider has one of the deadliest venoms. It is considered the world’s most venomous spider by the Guinness Book of World Records. While they are only native to Brazil, these spiders, also called banana spiders, have been found amongst bananas harvested and shipped around the world. There was a recent story of one being found in a Whole Foods produce department in Oklahoma! 7.Poecilotheria Rajaei The existence of these spiders was first discovered in 2009 on the island nation of Sri Lanka. From the tarantula family, they are not quite the largest spiders in the world, but they are very big with a leg span of 8 inches and enough deadly venom to kill mice, snakes and even small birds. Spider enthusiasts consider them to be very good looking spiders with subtle gray, pink and yellow markings and a unique pinkish gray band on its abdomen. 6.Colombian Giant Black Tarantula This tarantula is found in the tropical rainforests of Columbia and Brazil. It is extremely aggressive and nervous by nature and is also known for its odd defensive behaviors. When seeing a predator it will stretch out its legs and bob up and down in an effort to scare off its attacker. With a leg span of up to 9 inches it is no more than a scary sight to us as its venom is not powerful enough to do much to a human being. 5.Egyptian Giant Solpugid Also known as Camel Spiders these arachnids can grow to be very large, as seen in this photo. They have always been very well known and feared in Middle Eastern cultures, with rumors of them running faster than humans and having an unequaled appetite for large mammals. While these rumors aren’t true they are very speedy and deadly predators in the spider community. Western culture got to know them very well during the war in Iraq in the early 2000’s when stories of these spiders accompanied with videos and pictures began to circulate the internet. 4.Brazilian Salmon Pink Birdeater These spiders have a 10 inch leg span, making them near the longest in the world. They have a very interesting way of hunting prey. It’s body is brown and contains salmon pink hairs that it shoots at its prey to disable them. It then pounces on its victim and spits digestive juices on it before consuming it. While they occasionally eat small birds, like most spiders it prefers insects or small lizards. 3.Brazilian Giant Tawny Red Tarantula This spider is one of the biggest in the world with a leg span of just over 10 inches. It is quite a calm spider unless provoked and is happiest when it is hanging out in a dry, humid environment and has mice, insects and crickets to eat. Because of their calm demeanor they are often kept as pets in many parts of the world. 2.Giant Huntsman Spider If you were going by leg span, the giant huntsman spider is the biggest spider in the world with a length of up to 1 foot. No one even knew of the existence of these spiders until they were discovered in a cave in Laos in 2001. Getting their name from their incredible ability to track down and kill their prey, they mostly feed on small insects and lizards. While getting bit by one would hurt a lot, their venom is not deadly to humans. 1.Goliath Bird Eating Spider This mammoth spider is found in the rain forests of the northern part of South America. When considering sheer mass this spider is considered the largest in the world weighing in at almost half a pound. It is very interesting to note that female spiders live 15 to 25 years while their male counterparts die soon after reaching maturity, a lifespan of only 3 to 6 years. Like so many other creatures in their habitat these spiders are in danger of extinction due to the destruction of the rainforests.
Views: 4957268 Talltanic
The World's Biggest Webs That are Home To Thousands of Spiders
 
04:36
The biggest spider webs ever seen. 😊 SUBSCRIBE & turn notifications on - https://goo.gl/28Wp3u Facebook - https://www.facebook.com/WeAmaze-533377387104748 Twitter - https://twitter.com/Weamazeyt For copyright matters/credits, please contact me at me [email protected] Images and videos are used under YouTube's fair usage policy. Licensed Under Creative Commons https://creativecommons.org/licenses/by/3.0/
Views: 825 WeAmaze
Make A Spider Web Maker Gun | Hot Glue Gun Web Shooter (DIY) Cobweb Spinner
 
06:46
For the most realistic fake spider webs make a DIY cobwebbing webcaster hot glue gun web shooter for halloween or stage scenes. Need spooky cobwebs for Halloween make a hot glue gun into a hot glue web gun or webcaster. How to make a realistic looking spider web cobweb shooter. We share how we made our DIY cobweb gun. It's easy to make and convert a regular hot glue stick gun into a spider web making cobweb spinning easy to use gun. No extreme holiday yard haunter decorator should be without one of these web casters. There are several great web guns on the market to buy but if your like us and have fun making your own stuff then this video may help give you some ideas. Just follow along with these easy to follow steps like drilling holes and assembling plumbing parts from an ice maker kit and quick connect to air hoses and then hooking to an air supply or small air compressor and you can create movie set quality creepy cob webs. We also show you how we use the web guns and our techniques. Watch these realistic spider webs form on our Old Western Mining Ghost Town we made for Halloween. For more prop making videos check out our YouTube Channel http://www.youtube.com/user/HollywoodHaunter Visit our Facebook Page https://www.facebook.com/HollywoodHaunter If you found this video helpful or entertaining please give us a thumbs up and be sure to subscribe to our channel. Thank you so much for watching our video and supporting our channel. Danosongs.com coppermountain Incompetech.com Delay Rock http://www.hollywoodhaunter.com/ http://youtu.be/51lSU0Odkn4 #halloween #halloweendecorations #hollywoodhaunter
Views: 89604 Hollywood Haunter
Luigi's Mansion Dark Moon - Gloomy Manor - A-5 Sticky Situation (Nintendo 3DS Gameplay Walkthrough)
 
24:06
Thanks for every Like and Favorite! They really help! This is Part 5 of the Luigi's Mansion Dark Moon Gameplay Walkthrough for the Nintendo 3DS! It includes A-5 Sticky Situation of the Gloomy Manor. I'm ZackScott! Subscribe if you have not! New videos every day! http://youtube.com/subscription_center?add_user=zackscottgames MORE GAMES: http://youtube.com/user/ZackScottGames/videos?flow=grid&view=1 BUY ZACKSCOTT SHIRTS: http://zackscott.spreadshirt.com SUBMIT LOL REPLAYS: http://j.mp/LOLReplaySubmit Thanks for watching my Luigi's Mansion Dark Moon Gameplay and Walkthrough on the 3DS! The Nintendo 3DS is awesome and Luigi's Mansion is too, so I'm excited to see how this game turns out! You may have seen the trailer or demo, but this playthrough will include everything! If you're a fan of Nintendo or the Luigi's Mansion series, then let's play Luigi's Mansion Dark Moon! Subscribe to ZackScottGames for new episodes of Luigi's Mansion Dark Moon today! SCARE UP SOME FUN Luigi returns in an all new puzzle-solving spooky adventure! Join Luigi as he stumbles and bumbles through haunted mansions, solving mind-melting puzzles and vacuuming up ghosts left and right with the help of Professor E. Gadd and an array of gadgets. Each mansion is filled with unique puzzles, a wide range of different ghosts, and a menacing boss battle. You'll need to use your head and the Poltergust 5000, a ghost-catching vacuum cleaner, to clean up the mansions and save the day. With so many new places to explore and all new ways to capture ghosts, Luigi's Mansion: Dark Moon is another star turn for Mario's heroic brother—and it's only on Nintendo 3DS. ZACKSCOTT CHANNELS http://youtube.com/ZackScott http://youtube.com/ZackScottFunClub http://youtube.com/ZackScottGames http://youtube.com/ZackScottPets FOLLOW ZACKSCOTT http://facebook.com/ZackScott http://instagram.com/ZackScott http://twitter.com/ZackScott http://ZackScott.tumblr.com LUIGI'S MANSION DARK MOON INFO Name: Luigi's Mansion: Dark Moon Developer: Next Level Games Publisher: Nintendo Platforms: Nintendo 3DS Release Date: March 24th, 2013
Views: 1473496 ZackScottGames
Halloween Decor DIY Embroidery Hoop Spider Webs
 
01:10
Embroidery Hoop Spider Webs Weave a Tangled Web for Halloween Here’s a project that’s the perfect combo of beautiful and creepy. It’ll make you wonder, Who’s been doing crafts in the attic? Grandma’s lace never looked so goth. Materials: Hot glue gun Glue sticks Embroidery hoops, various sizes A few yards of lace in various patterns Plastic spiders Scissors Instructions: Place lace between hoops, pull tight and tighten screws. Trim excess lace. Glue spiders on the lace.
TRIPPING ON WEBS |SPIDER-MAN PS4 ( Walkthrough gameplay) episode 20
 
21:08
Remember kids. If a scorpion infects you with poison dont swing on webs. Its too much of a trip. Eat strange plants instead.
The Amazing Spider-Man Parkour
 
02:51
How does Spider-Man get around when he runs out of webs? Parkour! Behind The Scenes - http://youtu.be/Jx2x3fjtTgQ Featuring Parkour Athlete Ronnie Shalvishttp://www.ronniestreetstunts.com http://www.facebook.com/ronniestreetstunts http://www.twitter.com/ronnieshalvis http://www.instagram.com/ronniestreetstunts Directed By: Cameron Manwaring and Chris Jordan As always, a special thanks to Cameron Manwaring and Contagious for their consulting, marketing, and production for my channel! Over the past 2 years, they have worked with me on all my biggest videos and continue to help me reach my goal to become a full-time stunt man and coordinator! Check them out at https://www.contagious.me Also, huge shout out to Chris Jordan & Bryan K from SkyCandy! Without them and their mad skills this couldn't have happened. While working with me and Contagious, they were super professional, and nailed some shots we could only dream of! Subscribe to their channels below: https://Youtube.com/user/flyskycandy http://Facebook.com/flyskycandy http://Twitter.com/flyskycandy http://Vimeo.com/flyskycandy http://Flyskycandy.com Edit by: Joel Bergvall https://youtube.com/joelbergvall VFX for the webs and BTS video footage: Zeb Jackson https://www.youtube.com/vizibilityzero Stunt Coordination: Chris Romrell Check out Chris Romrell's Channel! https://www.youtube.com/channel/UCKsMp6qd3mXcmmpQZIoycDg Ronnie and Chris are from the CBR Stunt Team http://www.youtube.com/cbrstuntteam Red Epic Drone Pilot: Chris Jordan Camera Operators: Bryan Kendrick, Chris Jordan Freefly Movi Runners: Bryan Kendrick Bryce Jurgensmeier, Cameron Manwaring Onsite Security: Kyle Coats, Bryce Jurgensmeier For business inquiries email me at [email protected] Check out my recommended parkour products on Amazon. Best Parkour Shoes, Apparel, Fitness Equipment and Film Gear. https://www.amazon.com/shop/ronniestreetstunts
Views: 15624352 Ronnie Street Stunts
No Doubt-Spider Webs
 
04:29
Lyrics: You think that we connect That the chemistry's correct Your words walk right through my ears Presuming I likn what I hear And now I'm stuck in the The web you're spinning You've got me for your prey Sorry I'm not home right now I'm walking into spiderwebs So leave a message And I'll call you back A likely story, but leave a message And I'll call you back You're intruding on what's mine And you're taking up my time Don't have the courage inside me To tell you please let me be Communication, a telephonic invasion I'm planning my escape... Sorry I'm not home right now I'm walking into spiderwebs So leave a message And I'll call you back A likely story, but leave a message And I'll call you back And it's all your fault I screen my phone calls No matter who calls I gotta screen my phone calls Now it's gone to deep (Now, it's gone too deep) You wake me in my sleep (Wake me in my sleep) My dreams become nightmares (Dreams become nightmares) 'Cause you're ringing in my ears Sorry I'm not home right now I'm walking into spiderwebs So leave a message And I'll call you back A likely story, but leave a message And I'll call you back And it's all your fault I screen my phone calls No matter-matter-matter-matter who calls I gotta screen my phone calls Oooh, the spiderwebs Leave a message And I'll call you back I'm walking into spiderwebs So, leave a message And I'll call you back It's all your fault I screen my phone calls No matter-matter-matter who calls I gotta screen my phone calls It's all your fault It's all your fault No matter who calls No matter who calls I'm walking into spiderwebs so, Leave a message And I'll call you back I'm walking into spiderwebs so, Leave a message And I'll call you back It's all your fault (I'm walking in the spiderwebs) No matter who calls (So leave a message and I'll call you back) I gotta screen my phone calls (I'm walking in the spiderwebs) It's all your fault (So leave a message and I'll call you back) No matter-matter-matter who calls (I'm walking in the spiderwebs) I screen my phone calls (So leave a message and I'll call you back) I'm walking into spiderwebs Leave a message and I'll call you back Thanx 4 over 1,000 views! I didn't think it would get that many! leave me a comment of your opinon: Which is better, No Doubt or Gwen Stefani solo?
Views: 133921 kidomaru9
Mod Melt Glow Spider Webs
 
01:05
Join hosts Cathie Filian and Steve Piacenza as they show you how to make fun spiderwebs with Mod Melts and Glow-In-The-Dark Mod Podge for your Halloween projects. Subscribe for more fun and informative Plaid videos! → https://www.youtube.com/c/plaidcrafts?sub_confirmation=1 ▷ Check out these other videos……. 👑 Related Video ► https://youtu.be/JYi9peuBAPU 💑 Related Video ► https://youtu.be/_tii91aRfvQ 👹 Related Video ► https://youtu.be/jKDh4-y2lq4 ▷ FOLLOW US FOR MORE CRAFTINESS!! BLOG ‣https://plaidonline.com/blog TWITTER ‣https://twitter.com/plaidcrafts INSTAGRAM ‣https://www.instagram.com/plaidcrafts/ FACEBOOK ‣https://www.facebook.com/InspiredByPlaid Plaid’s channel offers inspiration and ideas for creative living. Use our trusted techniques and how-to’s, crafts, entertaining, holiday projects and more to add a dash of DIY to your life!
Views: 3079 Plaid Crafts
WILL IT BITE?! - Black Widow Challenge
 
10:16
Please SUBSCRIBE - http://bit.ly/BWchannel Pre-Order Coyote’s Book - http://bit.ly/BOOKbraveadventures Watch More - http://bit.ly/BTbscorp1 In this segment of On Location, Coyote free handles a Black Widow spider! Yes you read that correct, in an attempt to prove that this widely feared arachnid is actually rather docile and always more interested in avoiding humans than inflicting a bite, Coyote will attempt hold one with his bare hands. He does this with the confidence that these mild mannered creatures will actually remain calm if unprovoked…but there is always the slight chance and the question...WILL IT BITE?!   Well if Coyote is bitten the consequences will be extremely painful and potentially deadly, so the team will be on standby to call for medics just incase the worst scenario actually unfolds…to be BITTEN by a Black Widow Spider! YIKES! Get ready, this video is going to be INTENSE! Thank you for joining us On Location! In these segments you will get a behind the scenes look at all of the fun and exciting things Coyote and team experience on their adventures when they’re NOT encountering wildlife…or at least not by choice! The Brave Wilderness Channel is your one stop connection to a wild world of adventure and amazing up close animal encounters! Follow along with adventurer and animal expert Coyote Peterson and his crew as they lead you on three exciting expedition series - Breaking Trail, Dragon Tails and Coyote’s Backyard - featuring everything from Grizzly Bears and Crocodiles to Rattlesnakes and Tarantulas…each episode offers an opportunity to learn something new. So SUBSCRIBE NOW and join the adventure that brings you closer to the most beloved, bizarre and misunderstood creatures known to man! GET READY...things are about to get WILD! New Episodes Every Wednesday and Friday at 7AM EST! Subscribe Now! https://www.youtube.com/BraveWilderness Buy Coyote’s Book! http://bit.ly/BOOKbraveadventures Find more info at: https://www.CoyotePeterson.com Coyote Peterson on Twitter: https://twitter.com/CoyotePeterson Coyote Peterson on Facebook: https://www.facebook.com/CoyotePeterson Coyote Peterson on Instagram: https://www.instagram.com/CoyotePeterson Coyote Peterson G+: https://plus.google.com/100310803754690323805/about
Views: 30045079 Brave Wilderness
Hauntingly huge spider spotted in Australia
 
00:40
A woman in Australia got quite a fright when she saw a giant spider on her home on July 23.
Views: 150517 ABC News
Spiders and Webs (with upbeat Music) Get over fear / Sensory Activating
 
11:31
Look at the beautiful artistic body of the spider close up, without worrying or being scared of the spider. The dew drops on the web demonstrate the artist that the spider really is, with it's intricate handiwork. Music is activating to arouse the senses while you get the opportunity to enjoy the beauty of it all.
Views: 173 CallOTChrissy